pprc1

Ensembl ID:
ENSDARG00000090337
ZFIN ID:
ZDB-GENE-030131-9858
Human Orthologue:
PPRC1
Human Description:
peroxisome proliferator-activated receptor gamma, coactivator-related 1 [Source:HGNC Symbol;Acc:3002
Mouse Orthologue:
Pprc1
Mouse Description:
peroxisome proliferative activated receptor, gamma, coactivator-related 1 Gene [Source:MGI Symbol;Ac

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35433 Nonsense Mutation detected in F1 DNA During 2017
sa22245 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35433
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125430 Nonsense 1078 1220 11 14
Genomic Location (Zv9):
Chromosome 13 (position 11764892)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 11878423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTAAACCTGTTTAAATTTTATTGACAGCCCTGATCAGAGGCCTGGATA[T/A]CATCATGTTCAAAATAGCAGTGAGGATACAAAAAGGCGCAAAGAGAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125430 Nonsense 1184 1220 13 14
Genomic Location (Zv9):
Chromosome 13 (position 11764357)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 11877888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATTTGACCTGTGCTTTGGAGGGAGGCGGCAGTTTTGCAAGGCCAGCTA[T/A]GCTGATCTTGGTGAGCTAACAATGATTTCTTTCGTTTCTAGGTATTTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link