ENSDARG00000090335

Ensembl ID:
ENSDARG00000090335

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41074 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15587 Nonsense Available for shipment Available now
sa17505 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122698 Essential Splice Site 52 584 1 10
Genomic Location (Zv9):
Chromosome 7 (position 69942044)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67664713
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTCAAGACGACACAACTCCAGCGAGACACAGACTGTCTTCACAAACAG[G/A]TAAACACACACACACTCACACACACACAAAAACACAGAGAGACAGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15587
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122698 Nonsense 396 584 7 10
Genomic Location (Zv9):
Chromosome 7 (position 69915832)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67638501
KASP Assay ID:
2259-9785.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAAAGGCAGAAGGAGAAAGAGTGCGCCTCSCTCMAAACACAACTGCTT[C/T]AGYTCAGAGAACAACTGAAAGAGGCCAACACCACCTGCAGAGACACYGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122698 Nonsense 458 584 8 10
Genomic Location (Zv9):
Chromosome 7 (position 69912522)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67635191
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCTGCTGGAGGCTGAAAAAGCCCACAGAAAACTCCAGGCTGAGCTC[A/T]AGAGAACCACAGACRGTCTGGAAAACACCCAGCTGGAGCTGCAGGACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link