ENSDARG00000090320

Ensembl ID:
ENSDARG00000090320
Human Orthologues:
MSLN, MSLNL
Human Descriptions:
mesothelin [Source:HGNC Symbol;Acc:7371]
mesothelin-like [Source:HGNC Symbol;Acc:14170]
Mouse Orthologues:
Msln, Mslnl
Mouse Descriptions:
mesothelin Gene [Source:MGI Symbol;Acc:MGI:1888992]
mesothelin-like Gene [Source:MGI Symbol;Acc:MGI:3607710]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7418 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122050 Missense 248 378 6 8
Genomic Location:
Chromosome 1 (position 60201000)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGTTCCCGCAGGTCCAGCTGCTCGTCAGTAAGTAYCTGRGTGTGA[A/T]GGGAAACACTCTCGGCACCAATGAGCTGAACGYACTCGGGGGAACAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/al345uac