SHISA8 (2 of 2)

Ensembl ID:
ENSDARG00000090314
Description:
shisa homolog 8 (Xenopus laevis) [Source:HGNC Symbol;Acc:18351]
Human Orthologues:
SHISA8, SHISA9
Human Descriptions:
shisa homolog 8 (Xenopus laevis) [Source:HGNC Symbol;Acc:18351]
shisa homolog 9 (Xenopus laevis) [Source:HGNC Symbol;Acc:37231]
Mouse Orthologue:
Shisa9
Mouse Description:
shisa homolog 9 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:1919805]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22394 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128615 Nonsense 71 228 1 2
Genomic Location (Zv9):
Chromosome 13 (position 53693517)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 24773545
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGAACCGGAAGAAATTCCAGCAGCCGGGAGCCGTTGTTGGGGTTACTA[T/A]GACGTGATGGGCCAATGGGATCCCCCGTTTAACTGTAACGCAGGAATCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link