ENSDARG00000090313

Ensembl ID:
ENSDARG00000090313
Human Orthologues:
GPR114, GPR56, GPR97
Human Descriptions:
G protein-coupled receptor 114 [Source:HGNC Symbol;Acc:19010]
G protein-coupled receptor 56 [Source:HGNC Symbol;Acc:4512]
G protein-coupled receptor 97 [Source:HGNC Symbol;Acc:13728]
Mouse Orthologues:
Gpr114, Gpr56, Gpr97
Mouse Descriptions:
G protein-coupled receptor 114 Gene [Source:MGI Symbol;Acc:MGI:2685955]
G protein-coupled receptor 56 Gene [Source:MGI Symbol;Acc:MGI:1340051]
G protein-coupled receptor 97 Gene [Source:MGI Symbol;Acc:MGI:1859670]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30410 Nonsense Mutation detected in F1 DNA During 2017
sa30411 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30410
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123133 Nonsense 234 310 4 5
Genomic Location (Zv9):
Chromosome Zv9_NA892 (position 6362)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150425.1 6362
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCAGCTGATGATGGTGTTGAGTTTGTTTATTCTGTTTGGTCTGACGTG[G/A]GCTGTTGCCTTCTTCAGTTATGGACCGATGCTCATTCCCTCATATTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30411
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123133 Nonsense 242 310 4 5
Genomic Location (Zv9):
Chromosome Zv9_NA892 (position 6384)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150425.1 6384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGTTTATTCTGTTTGGTCTGACGTGGGCTGTTGCCTTCTTCAGTTAT[G/T]GACCGATGCTCATTCCCTCATATTACATCTTCTGTGCGCTCAACTCCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link