LDLRAD2

Ensembl ID:
ENSDARG00000090297
Description:
low density lipoprotein receptor class A domain containing 2 [Source:HGNC Symbol;Acc:32071]
Human Orthologue:
LDLRAD2
Human Description:
low density lipoprotein receptor class A domain containing 2 [Source:HGNC Symbol;Acc:32071]
Mouse Orthologue:
Ldlrad2
Mouse Description:
low density lipoprotein receptor A domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:3588210]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14056 Nonsense Available for shipment Available now
sa6218 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128245 Nonsense 124 378 2 5
Genomic Location:
Chromosome 11 (position 37323152)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGTCGTCTGCATCTGGCCTGACCCGGCCTGACCTGGAGCCCACCACT[G/T]AAGARGGGCCCGAAGACCCCTGCCATGCTGGATCTTATATCCAGTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128245 Essential Splice Site 244 378 3 5
Genomic Location:
Chromosome 11 (position 37325706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAACTGTGGGGACGGCAGTGACTTAATAGATTACCCTGGTTGCAATGG[T/A]ACAGTATTGMTTTTAAACRGRCATTTTCACCTGGAGTTAGTTTYGGAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4eo09xgv