LDLRAD2

Ensembl ID:
ENSDARG00000090297
Description:
low density lipoprotein receptor class A domain containing 2 [Source:HGNC Symbol;Acc:32071]
Human Orthologue:
LDLRAD2
Human Description:
low density lipoprotein receptor class A domain containing 2 [Source:HGNC Symbol;Acc:32071]
Mouse Orthologue:
Ldlrad2
Mouse Description:
low density lipoprotein receptor A domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:3588210]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14056 Nonsense Available for shipment Available now
sa6218 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35139 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128245 Nonsense 124 378 2 5
Genomic Location (Zv9):
Chromosome 11 (position 37323152)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36220380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGGGTCGTCTGCATCTGGCCTGACCCGGCCTGACCTGGAGCCCACCACT[G/T]AAGARGGGCCCGAAGACCCCTGCCATGCTGGATCTTATATCCAGTTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6218
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128245 Essential Splice Site 244 378 3 5
Genomic Location (Zv9):
Chromosome 11 (position 37325706)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36222934
KASP Assay ID:
554-5293.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAACTGTGGGGACGGCAGTGACTTAATAGATTACCCTGGTTGCAATGG[T/A]ACAGTATTGMTTTTAAACRGRCATTTTCACCTGGAGTTAGTTTYGGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128245 Nonsense 322 378 5 5
Genomic Location (Zv9):
Chromosome 11 (position 37330029)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36227257
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGACGGCGGCTGGTGTTCTGCTCTGCTGGTGCTGCTGGGCTCCTGGAT[G/A]GTTCCTGTGGCGCGTCAGTGTGTTCCGCTTTATGCCTTGCTGTAACTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link