RALYL (2 of 2)

Ensembl ID:
ENSDARG00000090292
Description:
RALY RNA binding protein-like [Source:HGNC Symbol;Acc:27036]
Human Orthologue:
RALYL
Human Description:
RALY RNA binding protein-like [Source:HGNC Symbol;Acc:27036]
Mouse Orthologue:
Ralyl
Mouse Description:
RALY RNA binding protein-like Gene [Source:MGI Symbol;Acc:MGI:1924147]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39855 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130903 Nonsense 181 214 6 7
Genomic Location (Zv9):
Chromosome 2 (position 31436348)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31736301
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACCTCGAGACAGAAAAAAATCCTGGCACGGATGTGGATGGGTGTCAT[C/T]AGGAAGCGGGGTCTTGGGAAGTGACTGACGAAGGTGATGACGGATATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link