serpina1

Ensembl ID:
ENSDARG00000090286
ZFIN ID:
ZDB-GENE-030131-1421
Description:
serine proteinase inhibitor, clade A, member 1 [Source:RefSeq peptide;Acc:NP_001071226]
Human Orthologue:
SERPINA10
Human Description:
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 [Source:HGNC Sy
Mouse Orthologues:
Gm46, Serpina10
Mouse Descriptions:
predicted gene 46 Gene [Source:MGI Symbol;Acc:MGI:2684892]
serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 G

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18519 Nonsense Available for shipment Available now
sa36986 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43393 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa18519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113927 Nonsense 19 429 1 4
ENSDART00000125398 Nonsense 24 434 2 5
Genomic Location (Zv9):
Chromosome 20 (position 10732666)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10558340
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATATATACTGCTGTGCAATTGCTGCCTTGCTGGTAGCAACGGCCTG[G/A]GCKGCACCCCACGATGGCCATGWAGGCCATGACCATGGTAGCCACACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113927 Essential Splice Site 318 429 2 4
ENSDART00000125398 Essential Splice Site 323 434 3 5
Genomic Location (Zv9):
Chromosome 20 (position 10733667)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10559341
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCTGCAGACACCATCTTAAGAACTGGCATGATAAACTCTTCAGAAG[G/A]TAATATTACTGATACCTCAGGATTTAGATCCATGGTCAGTTGGTTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113927 Splice Site, Nonsense 367 429 3 4
ENSDART00000125398 Splice Site, Nonsense 372 434 4 5
Genomic Location (Zv9):
Chromosome 20 (position 10733908)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10559582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAAAGCAGATTTCTCTGGGATGACAGAGGAGGTTAAAGTAAAAGTGTCT[C/T]AGGTATGTGAGGACTTGTTTTTACTTCTTGAAGCATCACTGATGGTAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link