LOC571329

Ensembl ID:
ENSDARG00000090282

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32551 Nonsense Mutation detected in F1 DNA During 2017
sa30333 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130816 Nonsense 494 1091 2 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3465 (position 353252)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 71550220
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGGAGTTTCTAGCCGCTTTCTGCGTGTTCTACTCGCATTTGACGAAG[A/T]AAATTGAGTTATTGCAGTTGTTTCTTGATGATGAACATGAGAGGTACGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130816 Essential Splice Site 845 1091 5 8
Genomic Location (Zv9):
Chromosome Zv9_scaffold3465 (position 344024)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 71540992
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTCTCTGATGGACTGAAGAGTTTACACTGTCAGCTCAACATACTCAG[G/T]TATATAAGACTAAAGCCTTGTTTATACTCGACGCGTCCGCTTGTTCGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link