CDHR5 (2 of 2)

Ensembl ID:
ENSDARG00000090275
Description:
cadherin-related family member 5 [Source:HGNC Symbol;Acc:7521]
Human Orthologue:
CDHR5
Human Description:
cadherin-related family member 5 [Source:HGNC Symbol;Acc:7521]
Mouse Orthologue:
Cdhr5
Mouse Description:
cadherin-related family member 5 Gene [Source:MGI Symbol;Acc:MGI:1919290]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25373 Nonsense Mutation detected in F1 DNA During 2014
sa25372 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18896 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Nonsense 8 728 1 14
Genomic Location:
Chromosome 7 (position 58623722)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTCCCACTCAACGGGCAGCACAGTCAATGCTTTATGTGAAGAAGTAC[C/T]AGCTGGTGACACGGTCTCATAGTCCTCCATGGTTATTTGTGTGTATTAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25372
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Essential Splice Site 137 728 3 14
Genomic Location:
Chromosome 7 (position 58616572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGAGCTGACTGTCCAAGTCCGATGTAATAAAACTGGCTACAGAAGC[G/A]TAAGTTGAGTCAATTTACAGTTCAGTAAATTCTGCTCAGATGATTGTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130122 Nonsense 218 728 6 14
Genomic Location:
Chromosome 7 (position 58609955)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAAGACCATGTATACACCAAACATCCTTGTCAACAAGGTTTTAGATTA[T/A]GATGTCATCCAGCAGGTGAAGCTGATCTTGTATGTGCAGGTATGTGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9or5i40a