LOC100333504

Ensembl ID:
ENSDARG00000090194
Human Orthologue:
HBXIP
Human Description:
hepatitis B virus x interacting protein [Source:HGNC Symbol;Acc:17955]
Mouse Orthologue:
Hbxip
Mouse Description:
hepatitis B virus x interacting protein Gene [Source:MGI Symbol;Acc:MGI:1915826]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27202 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27202
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126897 Essential Splice Site 33 91 2 4
Genomic Location (Zv9):
Chromosome 8 (position 25593306)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 24721224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTATTGTTGGGGTTTTGTGCACAGACGCTCAAGGACATAATCTAGGGTG[T/C]AAGTAATTTTTATATTTTCCTTAATACTTCCCTTAGTATAGTTTTCCTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link