bcam

Ensembl ID:
ENSDARG00000090190
ZFIN ID:
ZDB-GENE-060929-620
Description:
basal cell adhesion molecule [Source:RefSeq peptide;Acc:NP_001070095]
Human Orthologue:
BCAM
Human Description:
basal cell adhesion molecule (Lutheran blood group) [Source:HGNC Symbol;Acc:6722]
Mouse Orthologue:
Bcam
Mouse Description:
basal cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1929940]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32089 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000103176 Nonsense 30 547 2 13
ENSDART00000126602 Nonsense 30 604 2 16
ENSDART00000136982   None 243 None 8
Genomic Location (Zv9):
Chromosome 16 (position 26298090)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 24143765
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGTCTCTGTTCCTGTCTCTTTACAGTATGTTTGGCTTCAGTCACAGTC[A/T]AGGTGAATCCAGAAATGCACGTTCTTAAAGGAGATACAGTCATGCTGCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link