pttg1ipa

Ensembl ID:
ENSDARG00000090156
ZFIN ID:
ZDB-GENE-030131-505
Human Orthologue:
PTTG1IP
Human Description:
pituitary tumor-transforming 1 interacting protein [Source:HGNC Symbol;Acc:13524]
Mouse Orthologue:
Pttg1ip
Mouse Description:
pituitary tumor-transforming 1 interacting protein Gene [Source:MGI Symbol;Acc:MGI:2652132]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11306 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11306
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127209 Nonsense 58 220 1 7
Genomic Location (Zv9):
Chromosome 6 (position 11002079)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 10855705
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGACAGTCTTCAGCCACAACAGGAACACAATCTTCAACTACWACAACA[C/T]AATCKTCAACTACGACAACRCAGACTACTACKCAGTCTACAACTATACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link