si:ch211-271g18.1

Ensembl ID:
ENSDARG00000090132
ZFIN ID:
ZDB-GENE-081103-38

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20303 Nonsense Available for shipment Available now
sa33498 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa20303
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127949 Nonsense 5 694 1 2
ENSDART00000138768 Nonsense 5 632 1 2
Genomic Location (Zv9):
Chromosome 4 (position 36457130)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 36067259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTCTTGTTCTGTAGCTGTGAATGAGTGAAGCACCATGGCGAATGTT[A/T]AACAGCTGCTCGACAACTCACTGAATGAACTGGTAGAAGCTGAACTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127949 Nonsense 345 694 2 2
ENSDART00000138768 Nonsense 345 632 2 2
Genomic Location (Zv9):
Chromosome 4 (position 36455775)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 36068614
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAAACCTACATTGATCAGGTGACTGAGGTGCAAGGATTCAGTGATGAG[C/T]AAAAGGAGCAGTATTTCATCAAAAACAGCAGTCCTGAGGTTGCTGGAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link