ENSDARG00000090129

Ensembl ID:
ENSDARG00000090129
Human Orthologues:
MAMDC2, MDGA1, MDGA2
Human Descriptions:
MAM domain containing 2 [Source:HGNC Symbol;Acc:23673]
MAM domain containing glycosylphosphatidylinositol anchor 1 [Source:HGNC Symbol;Acc:19267]
MAM domain containing glycosylphosphatidylinositol anchor 2 [Source:HGNC Symbol;Acc:19835]
Mouse Orthologues:
Mamdc2, Mdga1, Mdga2
Mouse Descriptions:
MAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918988]
MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]
MAM domain containing glycosylphosphatidylinositol anchor 2 Gene [Source:MGI Symbol;Acc:MGI:2444706]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5146 Nonsense Mutation detected in F1 DNA During 2014
sa12311 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126223 Nonsense 120 550 4 14
Genomic Location:
Chromosome 2 (position 31290143)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTCATACAACAGGTCATTCAATGGCTGTGCTTGGAGCCAAACTTGAK[A/T]AACCAGAGGTCTCAAATCTTTTGACACCAGAGTATAGTCCATCTGCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12311
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126223 Splice Site, Nonsense 142 550 5 14
Genomic Location:
Chromosome 2 (position 31290326)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCAGTTACAGTTGATTCAGTATGATKTTTTGATAGAGGCTGTTTGTAG[G/A]TATCGGCTGTCTGCTGGCTCGGCTGATTCACTCTCAGTACATGTTCTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f7el6hlf