HCN2 (1 of 2)

Ensembl ID:
ENSDARG00000090115
Description:
hyperpolarization activated cyclic nucleotide-gated potassium channel 2 [Source:HGNC Symbol;Acc:4846
Human Orthologue:
HCN2
Human Description:
hyperpolarization activated cyclic nucleotide-gated potassium channel 2 [Source:HGNC Symbol;Acc:4846
Mouse Orthologue:
Hcn2
Mouse Description:
hyperpolarization-activated, cyclic nucleotide-gated K+ 2 Gene [Source:MGI Symbol;Acc:MGI:1298210]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14695 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14695
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131044 Nonsense 712 906 8 8
Genomic Location:
Chromosome 2 (position 55663141)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTCCAGGTGGTGCAGAATCTYGCCAGCCCGATAGCAATTTCTCCCCAA[C/T]AGTCTCTCCCAATAGCCTCTGCTATAGCCAGTCCACCTGTGCAAAGTCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b8guonwn