ENSDARG00000090107

Ensembl ID:
ENSDARG00000090107

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11324 Nonsense Available for shipment Available now
sa11254 Nonsense Available for shipment Available now
sa14135 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11324
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129690 Nonsense 105 378 1 2
ENSDART00000129690 Nonsense 105 378 1 2
Genomic Location:
Chromosome 22 (position 8590431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATCTAGATCCTTATGGTGTTGAGCAACGACGCAAAAATCGTCTAATC[C/T]GACGGAYGTATGTTAATCCTGGACCAAATTTCATGTGGCACGTCGACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11254
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129690 Nonsense 105 378 1 2
ENSDART00000129690 Nonsense 105 378 1 2
Genomic Location:
Chromosome 22 (position 8590431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATATCTAGATCCTTATGGTGTTGAGCAACGACGCAAAAATCGTCTAATC[C/T]GACGGAYGTATGTTAATCCTGGACCAAATTTCATGTGGCACGTCGACTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14135
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129690 Nonsense 307 378 2 2
Genomic Location:
Chromosome 22 (position 8591569)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTCCGATTCTGATGTACACCATCCCTCATCTTTTTGGAGGACAGGATTA[T/A]YTAAAAGAGGTTTCTCAGAATTCAGTGGATGTTTGTAAGCAAGAATGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3m7nmjld