LOC100331980

Ensembl ID:
ENSDARG00000090106
Human Orthologue:
SLC17A7
Human Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 [Source:HGNC
Mouse Orthologue:
Slc17a7
Mouse Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 Gene [Source

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37956 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24553 Nonsense Available for shipment Available now
sa37955 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa37956
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099869 Essential Splice Site 21 585 1 13
Genomic Location (Zv9):
Chromosome 24 (position 40110255)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38709912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGAGCGCTTTAAAGCGGTAGCGGCCAAAACACTTGGAAGGATAAACAG[G/T]TAAGATCCAAAAATTCATTAAACTTATTTTTAATATGCAAAAGCTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099869 Nonsense 98 585 2 13
Genomic Location (Zv9):
Chromosome 24 (position 40090062)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38689540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATCTGGGAGTGGCCGTCGTCAGCATGGTCAACAACCACACCGTCTAC[A/T]GAGATGGAAAACCCTACATTGTGGTAAGTAGAATTACGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099869 Essential Splice Site 106 585 3 13
Genomic Location (Zv9):
Chromosome 24 (position 40087989)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38686729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTTGGTATGTTTTAGATAAAGTGCATGTTTTGTGTTTGTGTGTTTC[A/G]GAAAGCACAGTTCTCCTGGGATCCAGAGACTGTAGGAATGATTCATGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link