LOC100331980

Ensembl ID:
ENSDARG00000090106
Human Orthologue:
SLC17A7
Human Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 [Source:HGNC
Mouse Orthologue:
Slc17a7
Mouse Description:
solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7 Gene [Source

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24553 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24553
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000099869 Nonsense 98 585 2 13
Genomic Location:
Chromosome 24 (position 40090062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAATCTGGGAGTGGCCGTCGTCAGCATGGTCAACAACCACACCGTCTAC[A/T]GAGATGGAAAACCCTACATTGTGGTAAGTAGAATTACGTGTGTGTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b1mrvybd