si:ch211-158m24.10

Ensembl ID:
ENSDARG00000090103
ZFIN ID:
ZDB-GENE-070705-71
Description:
Novel myosin family protein [Source:UniProtKB/TrEMBL;Acc:B8A559]
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7568 Missense Mutation detected in F1 DNA During 2017
sa30619 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12688 Nonsense Available for shipment Available now
sa14985 Nonsense Available for shipment Available now
sa31459 Nonsense Available for shipment Available now
sa6987 Nonsense Mutation detected in F1 DNA During 2017
sa20462 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7568
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098111   None 232 None 7
ENSDART00000139917 Missense 66 1222 3 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33889011)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31651243
KASP Assay ID:
554-4016.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATTCAGGTGTTCTTCAAAGCTGGTCTKCTGGGTACTCTTGAGGAGATG[C/A]GTGATGAGAAACTGGCTAGTCTGGTCACAATGACYCAGGCTCTCTGCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098111   None 232 None 7
ENSDART00000139917 Essential Splice Site 264 1222 None 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 33889845)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31652077
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACAGTATATATTGTAAAATAACTAAGCGTATTTGAAATCAAATCACAC[A/T]GGTTAAGAACTTGACAGAGGAAATGGCATCTCAGGATGAGAGCATTGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098111   None 232 None 7
ENSDART00000139917 Nonsense 664 1222 12 23
Genomic Location (Zv9):
Chromosome 5 (position 33892127)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31654359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGGGAATGTCAAAGGCAAACAGTGAGGTTGCTCAGTGGAGAACCAAATA[T/A]GAAACTGMTGCCATCCAGCGCACWGAAGARCTTGAAGAATCCAAGTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098111   None 232 None 7
ENSDART00000139917 Nonsense 736 1222 13 23
Genomic Location (Zv9):
Chromosome 5 (position 33892422)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31654654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATGTGGAGAGAGCCAATTCTTTGGCTGCCAACCTTGACAAAAAGCAG[A/T]GRAACTTTGACAAGGTAAAATATGTAGTCATGTTGTGATGTGATGTTCNT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31459
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098111   None 232 None 7
ENSDART00000139917 Nonsense 983 1222 17 23
Genomic Location (Zv9):
Chromosome 5 (position 33893585)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31655817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAACACTCTGATGCAGTCTGAGATCGAAGAGCTGAGAGCTGCTCTGGAG[C/T]AGACAGAGAGAGGACGCAAAGTGGCTGAACAAGAGCTGGTGGATGCCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6987
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098111 Nonsense 143 232 4 7
ENSDART00000139917 Nonsense 1132 1222 20 23
Genomic Location (Zv9):
Chromosome 5 (position 33894332)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31656564
KASP Assay ID:
554-4468.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGCAGAGCAGAGACGTGGAGCTGATGCTGTTAAAGGCGTCCGCAAATA[T/A]GAGAGGAGAGTCAAGGAGCTCACCTACCAGGTAAAGACATCAGAGCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20462
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098111 Nonsense 146 232 4 7
ENSDART00000139917 Nonsense 1135 1222 20 23
Genomic Location (Zv9):
Chromosome 5 (position 33894339)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 31656571
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGAGACGTGGAGCTGATGCTGTTAAAGGCGTCCGCAAATATGAGAGG[A/T]GAGTCAAGGAGCTCACCTACCAGGTAAAGACATCAGAGCACAAATTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link