ENSDARG00000090093

Ensembl ID:
ENSDARG00000090093

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27527 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27527
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124503 Nonsense 51 281 1 1
Genomic Location (Zv9):
Chromosome 10 (position 1025349)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1093524
KASP Assay ID:
2260-2705.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGTCAACTCTGTTACTGTCAACTCTGTTACTGTCTGTTAACCCTGTA[C/A]TGTCAACTCTGTTACTGTCTGTTAACCCTGTATTGTCAACTGTTACTGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link