ENSDARG00000090089

Ensembl ID:
ENSDARG00000090089
Human Orthologue:
ANO7
Human Description:
anoctamin 7 [Source:HGNC Symbol;Acc:31677]
Mouse Orthologue:
Ano7
Mouse Description:
anoctamin 7 Gene [Source:MGI Symbol;Acc:MGI:3052714]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23222 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15045 Essential Splice Site Available for shipment Available now
sa17920 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124233 Essential Splice Site 168 321 3 9
Genomic Location:
Chromosome 18 (position 6333372)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAAAGGGGACTTCAAGAGGAAGGCTTGGAAATCGAACAAGACAAAGAG[G/A]TTTGTGTGAATGCTTGTGTTGAACACCGAACACTATTCCTATTCCAATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15045
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124233 Essential Splice Site 285 321 7 9
Genomic Location:
Chromosome 18 (position 6348633)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGAAATTTTGAGGCGCACAGCCTGCACACAATCYTGTCAAACTATGG[G/T]TATGATTCAACAGAMACAAATAACACAATTAAAAYMGTCRTTTAGCTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17920
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124233 Essential Splice Site 305 321 9 9
Genomic Location:
Chromosome 18 (position 6348897)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAGTAAAGCTCNNNNNNNNNNNNNNNNNNNNNGTGTGTGTGTGTGTTTATTGCTGC[A/G]GGGAGACTTTGACAGCTCAGARGATAAAGAGYATCGCAACGACAGACAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xo5hd999