si:ch211-233f10.4

Ensembl ID:
ENSDARG00000090068
ZFIN ID:
ZDB-GENE-060526-118
Description:
Uncharacterized protein C9orf117 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2BDR7]
Human Orthologue:
C9orf117
Human Description:
chromosome 9 open reading frame 117 [Source:HGNC Symbol;Acc:27843]
Mouse Orthologue:
1700019L03Rik
Mouse Description:
RIKEN cDNA 1700019L03 gene Gene [Source:MGI Symbol;Acc:MGI:2447809]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40587 Essential Splice Site Mutation detected in F1 DNA During 2017
sa13152 Essential Splice Site Available for shipment Available now
sa26609 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130638 Essential Splice Site 284 471 5 8
Genomic Location (Zv9):
Chromosome 5 (position 67676279)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64477920
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTAATATATCTATATCCTAGAGCAAAATAAAGTCAAAGTCTTTCTCC[A/T]GGTGGTCCTTCAGTTGACAGAAAAGTGCAAGCAAATGCAGTCTGAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13152
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130638 Essential Splice Site 327 471 6 8
Genomic Location (Zv9):
Chromosome 5 (position 67676497)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64478138
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATACACCCAAGGGTGCATTTTAATAGCGTTACTCCCGCTGTATTACA[G/T]AAAGAAACATGCAGCGGTTACWGAAGACCTGAACCAAACCAAAGCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26609
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130638 Nonsense 393 471 7 8
Genomic Location (Zv9):
Chromosome 5 (position 67676763)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64478404
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAGGACGTCCCAGAGGAGGAAGACTCTGAGCTGAAGGTCACCGTCAGA[C/T]GAAGTCAGATGATGCAGAAGCTGCTGGCTGTTCTGGACGGCGCTGCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link