fa2h

Ensembl ID:
ENSDARG00000090063
ZFIN ID:
ZDB-GENE-031219-4
Description:
fatty acid 2-hydroxylase [Source:RefSeq peptide;Acc:NP_001038885]
Human Orthologue:
FA2H
Human Description:
fatty acid 2-hydroxylase [Source:HGNC Symbol;Acc:21197]
Mouse Orthologue:
Fa2h
Mouse Description:
fatty acid 2-hydroxylase Gene [Source:MGI Symbol;Acc:MGI:2443327]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8662 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121859 Essential Splice Site 214 377 4 8
Genomic Location:
Chromosome 25 (position 14000922)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGCTACTCTTTACTGGCACAAGAAACCACAAGACTGGTCATCTCATCAGG[T/C]AAGTCAAATGTGGGATTTAAGACACACAGTTGATTTACTTAAAGMCCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ln91bvul