LOC100330539

Ensembl ID:
ENSDARG00000090054
Human Orthologue:
ZNF318
Human Description:
zinc finger protein 318 [Source:HGNC Symbol;Acc:13578]
Mouse Orthologue:
Zfp318
Mouse Description:
zinc finger protein 318 Gene [Source:MGI Symbol;Acc:MGI:1889348]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16667 Nonsense Available for shipment Available now
sa28052 Nonsense Mutation detected in F1 DNA During 2015
sa16778 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122406 Nonsense 409 2230 4 12
Genomic Location:
Chromosome 13 (position 3976240)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACCTCAGACCTCACAGAGTTCCTTGGAATGATAGCMGAGGTAGCCCAA[C/T]AAMACAATCCAAAAAAGAGTCTTACAGAAATTGAAGACGAGGAGAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28052
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122406 Nonsense 532 2230 4 12
Genomic Location:
Chromosome 13 (position 3975871)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGCCTGGATCTCGGTGTGGCCGAAATAAGCAAGATGGCTGCAAGGACA[C/T]AAGAACGCCTCCACGGCAGCGTCCCTGCAAAAAAGACACCTGTTCGTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122406 Nonsense 640 2230 4 12
Genomic Location:
Chromosome 13 (position 3975545)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGTCCCAGAAAGCAACTGGCCTACAACMCCCACTCCTGCACAGAGYTA[T/A]CCTTCCCGACCTGGCGTTTTGCCGCATCCCCCTTACCCAGGACCTCCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/etng1h1r