ENSDARG00000090052

Ensembl ID:
ENSDARG00000090052
Human Orthologues:
GPR132, GPR4, GPR65, GPR68
Human Descriptions:
G protein-coupled receptor 132 [Source:HGNC Symbol;Acc:17482]
G protein-coupled receptor 4 [Source:HGNC Symbol;Acc:4497]
G protein-coupled receptor 65 [Source:HGNC Symbol;Acc:4517]
G protein-coupled receptor 68 [Source:HGNC Symbol;Acc:4519]
Mouse Orthologues:
Gpr132, Gpr4, Gpr65, Gpr68
Mouse Descriptions:
G protein-coupled receptor 132 Gene [Source:MGI Symbol;Acc:MGI:1890220]
G protein-coupled receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2441992]
G protein-coupled receptor 68 Gene [Source:MGI Symbol;Acc:MGI:2441763]
G-protein coupled receptor 65 Gene [Source:MGI Symbol;Acc:MGI:108031]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5409 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5409
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127162 Nonsense 295 353 3 3
Genomic Location:
Chromosome 7 (position 23876502)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCAGTGTTCGGTGGAAGTTTCCCTCTACCTGTACTATCGGATCTGCTA[C/A]GGSCTCACCAGCCTYAACACCCTCCTAGACCCTCTTTTCTACATTTTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4og9s3z9