LOC100334698

Ensembl ID:
ENSDARG00000090039
Human Orthologue:
RECK
Human Description:
reversion-inducing-cysteine-rich protein with kazal motifs [Source:HGNC Symbol;Acc:11345]
Mouse Orthologue:
Reck
Mouse Description:
reversion-inducing-cysteine-rich protein with kazal motifs Gene [Source:MGI Symbol;Acc:MGI:1855698]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13352 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129135 Essential Splice Site 60 128 1 2
Genomic Location:
Chromosome 24 (position 423963)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCATCATCCTCATCGCTCCTGTAGACCAGCAGCCYACACCACTGCAGG[T/A]CTGAGATCAGYCCTTAYCATACGRCACTATATAGACAACATCCACACCAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • IgG glycosylation: Loci associated with N-glycosylation of human immunoglobulin G show pleiotropy with autoimmune diseases and haematological cancers. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/66eenjxi