ENSDARG00000090038

Ensembl ID:
ENSDARG00000090038

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2163 Splice Site, Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa2163
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127576 Splice Site, Nonsense 218 414 3 7
Genomic Location (Zv9):
Chromosome 4 (position 19503724)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 20847059
KASP Assay ID:
554-3038.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGACACTCATAAATCTAGAGGTTTAATATCATTCTTTTTCTTGTTCAGA[T/A]GCTCCTCAGATCTTAAACTCCAGCTGTAACATTGGGAATGKAAATGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link