ENSDARG00000090030

Ensembl ID:
ENSDARG00000090030

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28347 Nonsense Mutation detected in F1 DNA During 2017
sa35734 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28347
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125634 Nonsense 421 1001 2 13
Genomic Location (Zv9):
Chromosome 14 (position 37865016)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149831.1 9401
KASP Assay ID:
2260-7795.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCCTTCCAAGTGGATACAATAATGGTGGCACTGAAGAATTTTGCAT[C/A]AATTGAAAATTTGCTTAAAGGAACAGTGGATAAAGCTCTCTGGAGTAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35734
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125634 Nonsense 857 1001 13 13
Genomic Location (Zv9):
Chromosome 14 (position 37872832)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149831.1 1585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCCGACTGTCTGAAGAGAACACAAAGGTGAAGCGTGTGGGAGAGAAA[C/T]AGCCGTATCCTGATCATCCAGACAGATTTGATTATTACGCTCAGGTGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link