LOC796966

Ensembl ID:
ENSDARG00000090013
Human Orthologue:
C15orf52
Human Description:
chromosome 15 open reading frame 52 [Source:HGNC Symbol;Acc:33488]
Mouse Orthologue:
A430105I19Rik
Mouse Description:
RIKEN cDNA A430105I19 gene Gene [Source:MGI Symbol;Acc:MGI:2685199]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9173 Nonsense Mutation detected in F1 DNA During 2014
sa12340 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124896 Nonsense 185 516 5 14
Genomic Location:
Chromosome 17 (position 2270113)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGATCTGGAGTCGAACACACGAGGAAAACAMCCTGCCGCTGTAAAG[A/T]GACTCACAGAGGTGAGCAGATCTTCTCGTTTGTGTTTGGGACGCCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124896 Nonsense 315 516 10 14
Genomic Location:
Chromosome 17 (position 2238096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACMGAAAGGGGAAAAGCRTTTCAGTGGTTTGCAGTAAAGCGAAGGGT[A/T]WAGACCGTCTGACGGGCCGAGCGAGGAGGTAAACTGACCACACACTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z8egp3sd