LOC796966

Ensembl ID:
ENSDARG00000090013
Human Orthologue:
C15orf52
Human Description:
chromosome 15 open reading frame 52 [Source:HGNC Symbol;Acc:33488]
Mouse Orthologue:
A430105I19Rik
Mouse Description:
RIKEN cDNA A430105I19 gene Gene [Source:MGI Symbol;Acc:MGI:2685199]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9173 Nonsense Mutation detected in F1 DNA During 2016
sa36287 Nonsense Mutation detected in F1 DNA During 2016
sa12340 Nonsense Available for shipment Available now
sa36286 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124896 Nonsense 185 516 5 14
Genomic Location (Zv9):
Chromosome 17 (position 2270113)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2315758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAGATCTGGAGTCGAACACACGAGGAAAACAMCCTGCCGCTGTAAAG[A/T]GACTCACAGAGGTGAGCAGATCTTCTCGTTTGTGTTTGGGACGCCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36287
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124896 Nonsense 227 516 7 14
Genomic Location (Zv9):
Chromosome 17 (position 2257544)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2303189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTGGCTGACCTAAACCTGATGCCGTCTGAGCAGGAGCAGCAGGAGTA[T/A]CTGCGCTGGAAGAAGGAGCGCGAGGAGATCGACCGCGAGCGTGTGGCCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124896 Nonsense 315 516 10 14
Genomic Location (Zv9):
Chromosome 17 (position 2238096)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2283741
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACMGAAAGGGGAAAAGCRTTTCAGTGGTTTGCAGTAAAGCGAAGGGT[A/T]WAGACCGTCTGACGGGCCGAGCGAGGAGGTAAACTGACCACACACTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36286
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124896 Nonsense 463 516 12 14
Genomic Location (Zv9):
Chromosome 17 (position 2231686)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2277331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACTGAAGAAAGGAAAACATCGTGTCCTGAAGCTGGAGATATATCAGCC[G/T]AAGCAGATGAAAAACAACCCGCTGAACACAGCAAGAGCTGCACTGCTAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link