ENSDARG00000090009

Ensembl ID:
ENSDARG00000090009
Human Orthologue:
CUZD1
Human Description:
CUB and zona pellucida-like domains 1 [Source:HGNC Symbol;Acc:17937]
Mouse Orthologues:
Cuzd1, Dmbt1
Mouse Descriptions:
CUB and zona pellucida-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:1202881]
deleted in malignant brain tumors 1 Gene [Source:MGI Symbol;Acc:MGI:106210]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43027 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129293 Nonsense 52 290 2 5
Genomic Location (Zv9):
Chromosome 18 (position 4401762)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 5151433
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTACCAGAAAACACGAGGTGGAGATTGAGGTCTCCTGCCGTTACGAGAAG[A/T]AAAATAACATAGCACTGGAGTTCACCGCAATAAGACACAGGACCACCGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link