GNGT2 (2 of 2)

Ensembl ID:
ENSDARG00000089997
Description:
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 [Source:HGN
Human Orthologue:
GNGT2
Human Description:
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 [Source:HGN
Mouse Orthologue:
Gngt2
Mouse Description:
guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 Gene [Sourc

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14609 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14609
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122684 Nonsense 43 69 2 2
Genomic Location:
Chromosome 12 (position 3858701)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTCAGGTTTCAGCAACAGCCCCAGAAATCATTGCATTTGTGGAGGGTT[T/G]ATCTGCCGAAGATCCTCTGGTTAAAGGTGTGCCAGAGGACAAGAACCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kkglcxlf