rnf146

Ensembl ID:
ENSDARG00000089981
ZFIN ID:
ZDB-GENE-030131-5997
Description:
RING finger protein 146 [Source:RefSeq peptide;Acc:NP_956148]
Human Orthologue:
RNF146
Human Description:
ring finger protein 146 [Source:HGNC Symbol;Acc:21336]
Mouse Orthologue:
Rnf146
Mouse Description:
ring finger protein 146 Gene [Source:MGI Symbol;Acc:MGI:1915281]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37779 Nonsense Mutation detected in F1 DNA During 2017
sa44042 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37779
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133356 Nonsense 191 364 2 2
ENSDART00000140623   None 185 None 3

The following transcripts of ENSDARG00000089981 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 40803438)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40636292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGATGAAGAGAGATGTTGTGGACATCCCTAAAAAAGGCGTGGCGGGAT[T/A]AAGACTCGATCCAGATCCTAATTCGTCAGCCGGAGCAGTTCCGGCGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133356 Nonsense 336 364 2 2
ENSDART00000140623   None 185 None 3

The following transcripts of ENSDARG00000089981 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 40803003)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 40635857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGATGAGCACACAGATGGGTCGCAGGGTAGGCATAGACTGCAGCAGT[T/A]GGACAGACCGCCCCCTGGTGGAGGGCCGGCGAACAGCGGAGATCGGTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link