LOC799543

Ensembl ID:
ENSDARG00000089974
Human Orthologue:
SLC15A5
Human Description:
solute carrier family 15, member 5 [Source:HGNC Symbol;Acc:33455]
Mouse Orthologue:
Slc15a5
Mouse Description:
solute carrier family 15, member 5 Gene [Source:MGI Symbol;Acc:MGI:3607714]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38095 Nonsense Mutation detected in F1 DNA During 2017
sa38096 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126552 Nonsense 373 533 6 10
Genomic Location (Zv9):
Chromosome 25 (position 29438936)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28129030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTCTCAGCACTGCTAGCAGGAATCTCAGAGATCCACAGGAAGGATTA[T/A]CCAGAGGTGGAGCAGACACTATCAGGAAAGGTCCTGCAGGTGTCATCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38096
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126552 Nonsense 437 533 7 10
Genomic Location (Zv9):
Chromosome 25 (position 29445828)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28135922
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTAGAGGCGTCTCTTTGCATTTCCTAACCCTCTCGTACGGAGGTGGCTG[C/A]TTTCTGGGAGCTTTCCTCATTCACTTGCTTTATTTTGTGTCAGGAGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link