TDRD6 (2 of 2)

Ensembl ID:
ENSDARG00000089954
Description:
tudor domain containing 6 [Source:HGNC Symbol;Acc:21339]
Human Orthologue:
TDRD6
Human Description:
tudor domain containing 6 [Source:HGNC Symbol;Acc:21339]
Mouse Orthologue:
Tdrd6
Mouse Description:
tudor domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2679727]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42864 Nonsense Mutation detected in F1 DNA During 2016
sa36303 Nonsense Mutation detected in F1 DNA During 2016
sa22990 Nonsense Mutation detected in F1 DNA During 2016
sa42863 Nonsense Mutation detected in F1 DNA During 2016
sa39141 Nonsense Mutation detected in F1 DNA During 2016
sa13845 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42864
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 309 1388 1 5
Genomic Location:
Chromosome 17 (position 6376316)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGATGGGTCTCCATGTGCAACAAAAGGTAGCGACGGGAAATGGTAC[C/T]GATCGGTTCTTCAGCAGAATGACATCTCAGATGTTGTCAAGGTCTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 375 1388 1 5
Genomic Location:
Chromosome 17 (position 6376116)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGTGTAATTGACAAAGGTGTTGGATGGCGGACAGATCAGATAGATTA[T/G]CTGAAATCTGTCATACTGGATCAAATCCTTGTTGGAAAGTTCGAGCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 531 1388 1 5
Genomic Location:
Chromosome 17 (position 6375648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAGATGAAGCTACACATAACCTGTGTGCAAAGCGTGAACCAGTTTTA[T/A]GGCCATTTTGCACAAAATACTGACGCCGTAACAAAAATGACCAAAGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 788 1388 5 5
Genomic Location:
Chromosome 17 (position 6374144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCACAAGAAATTGGAAACAGTAGTCACACGAAAGCAATCCAGCCAGAT[C/T]AGTTACGCCAAGGTGGAATTTGTTTGGCTCGCTTTTCTGACCAGCTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 1120 1388 5 5
Genomic Location:
Chromosome 17 (position 6373146)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGACGAACATCTGCTGTCATACCCAAGGTTCAGCATTCACTGCAGCTA[T/G]AGTTTAAATGACCAATTCAAGGGAATGAAGAAGCAGGAAATTCTCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 1338 1388 5 5
Genomic Location:
Chromosome 17 (position 6372494)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTGTCGGTTGGAAGGATTTAATCCCTCTGGAGGATYGTGGGATAGT[G/T]AGGCTACTGATAACTTCTACGAACTCTTGGTGGATAAACCTCTGAAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link