TDRD6 (2 of 2)

Ensembl ID:
ENSDARG00000089954
Description:
tudor domain containing 6 [Source:HGNC Symbol;Acc:21339]
Human Orthologue:
TDRD6
Human Description:
tudor domain containing 6 [Source:HGNC Symbol;Acc:21339]
Mouse Orthologue:
Tdrd6
Mouse Description:
tudor domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2679727]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22990 Nonsense Mutation detected in F1 DNA During 2014
sa13845 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22990
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 531 1388 1 5
Genomic Location:
Chromosome 17 (position 6375648)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAGATGAAGCTACACATAACCTGTGTGCAAAGCGTGAACCAGTTTTA[T/A]GGCCATTTTGCACAAAATACTGACGCCGTAACAAAAATGACCAAAGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13845
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 1338 1388 5 5
Genomic Location:
Chromosome 17 (position 6372494)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGTGTCGGTTGGAAGGATTTAATCCCTCTGGAGGATYGTGGGATAGT[G/T]AGGCTACTGATAACTTCTACGAACTCTTGGTGGATAAACCTCTGAAAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xxot2fga