LOC100332626

Ensembl ID:
ENSDARG00000089946
Human Orthologues:
CST6, CST7
Human Descriptions:
cystatin E/M [Source:HGNC Symbol;Acc:2478]
cystatin F (leukocystatin) [Source:HGNC Symbol;Acc:2479]
Mouse Orthologues:
Cst6, Cst7
Mouse Descriptions:
cystatin E/M Gene [Source:MGI Symbol;Acc:MGI:1920970]
cystatin F (leukocystatin) Gene [Source:MGI Symbol;Acc:MGI:1298217]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30532 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30532
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122643 Nonsense 23 139 2 3
Genomic Location (Zv9):
Chromosome Zv9_NA824 (position 535)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150663.1 535
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTAAGCTGAAAATGACAGATGTGAGTTGTTTTGGCTACAGAGAAAGGT[G/T]GAGTGCACCGAGTCTTCAGCAGGCCGATCCCAGGAGCTCTGCAGAATGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link