DIO3

Ensembl ID:
ENSDARG00000089937
Description:
deiodinase, iodothyronine, type III [Source:HGNC Symbol;Acc:2885]
Human Orthologue:
DIO3
Human Description:
deiodinase, iodothyronine, type III [Source:HGNC Symbol;Acc:2885]
Mouse Orthologue:
Dio3
Mouse Description:
deiodinase, iodothyronine type III Gene [Source:MGI Symbol;Acc:MGI:1306782]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6453 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6453
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122835 Nonsense 78 121 1 1
Genomic Location (Zv9):
Chromosome 17 (position 72827)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1388137
KASP Assay ID:
554-4514.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGACGGCATGGAGAACGCGGCCAACAGCGCGTACGGAGCTTACTTCGAC[A/T]GACTGTACATCGTGCAGGACGGGAGGGTGGTGTACCAGGGCGGCCGCGGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: The imprinted DLK1-MEG3 gene region on chromosome 14q32.2 alters susceptibility to type 1 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link