LOC798492

Ensembl ID:
ENSDARG00000089933
Human Orthologue:
RASAL3
Human Description:
RAS protein activator like 3 [Source:HGNC Symbol;Acc:26129]
Mouse Orthologue:
Rasal3
Mouse Description:
RAS protein activator like 3 Gene [Source:MGI Symbol;Acc:MGI:2444128]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25328 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25328
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124643 Essential Splice Site 343 1124 6 18
Genomic Location:
Chromosome 6 (position 9318418)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCAGGCCGGTCCACAGCTCTATTCTAGGGGAGAAGTACTGTTTTCAGG[T/C]AGACCTTGCAGTTGCGAATTACAGTGAAATCCAAATTACAGTGAATCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9oyiyeu8