si:dkey-21j8.2

Ensembl ID:
ENSDARG00000089930
ZFIN ID:
ZDB-GENE-090312-217
Human Orthologue:
IQCE
Human Description:
IQ motif containing E [Source:HGNC Symbol;Acc:29171]
Mouse Orthologue:
Iqce
Mouse Description:
IQ motif containing E Gene [Source:MGI Symbol;Acc:MGI:1921489]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31196 Nonsense Available for shipment Available now
sa14198 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31196
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123431 Nonsense 337 680 12 21
Genomic Location (Zv9):
Chromosome 1 (position 11049387)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11181464
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAAAGAATTGACCCAGGAAGAGATGAGCATGACGGACAGCCCTGCATG[C/A]AGAGCCAAGGGTACTTACATTCACAACAGAACTGGAAATATTTATCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123431 Nonsense 374 680 14 21
Genomic Location (Zv9):
Chromosome 1 (position 11046581)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 11178658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTNCAGAGATTGGAAAGGATGAAAAATCTTCAGAKCACYAAAGCGTCA[C/T]AAAAGAGCCTAGACGATACAGAATCAACRAATCAGAAYGCAGAGACCGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link