FCHSD2 (2 of 6)

Ensembl ID:
ENSDARG00000089928
Description:
FCH and double SH3 domains 2 [Source:HGNC Symbol;Acc:29114]
Human Orthologue:
FCHSD2
Human Description:
FCH and double SH3 domains 2 [Source:HGNC Symbol;Acc:29114]
Mouse Orthologue:
Fchsd2
Mouse Description:
FCH and double SH3 domains 2 Gene [Source:MGI Symbol;Acc:MGI:2448475]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6495 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6495
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123077 Essential Splice Site 82 175 4 6
Genomic Location:
Chromosome 18 (position 1949999)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGAGACTGGCCTGGGATWAAACCAGACGATCAGAGGACAGACTACAGG[T/C]GAGGGAAAACACTACAAATCTATGGCWATCAGCGCTGTGAGRGYCCCAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sq1jpx92