aldh2a

Ensembl ID:
ENSDARG00000089924
ZFIN IDs:
ZDB-GENE-040426-1262, ZDB-GENE-050417-465, ZDB-GENE-050417-465
Description:
aldehyde dehydrogenase 2 precursor [Source:RefSeq peptide;Acc:NP_956784]
Human Orthologue:
ALDH2
Human Description:
aldehyde dehydrogenase 2 family (mitochondrial) [Source:HGNC Symbol;Acc:404]
Mouse Orthologue:
Aldh2
Mouse Description:
aldehyde dehydrogenase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:99600]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3544 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3544
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016808 Essential Splice Site 226 516 6 13
ENSDART00000139483 Essential Splice Site 226 516 6 13
Genomic Location:
Chromosome 5 (position 72448021)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCAGACGCCGCTCACCGCACTGTATATYGCCAGTTTAATCAAAGAGG[T/C]GAATGACATTCAGACCTACTGAATAATTGCAAAATAACACTGTGATGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1tu89n20