CACNA1G

Ensembl ID:
ENSDARG00000089913
Description:
calcium channel, voltage-dependent, T type, alpha 1G subunit [Source:HGNC Symbol;Acc:1394]
Human Orthologue:
CACNA1G
Human Description:
calcium channel, voltage-dependent, T type, alpha 1G subunit [Source:HGNC Symbol;Acc:1394]
Mouse Orthologue:
Cacna1g
Mouse Description:
calcium channel, voltage-dependent, T type, alpha 1G subunit Gene [Source:MGI Symbol;Acc:MGI:1201678

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16676 Nonsense Available for shipment Available now
sa35306 Nonsense Mutation detected in F1 DNA During 2016
sa42044 Nonsense Mutation detected in F1 DNA During 2016
sa27964 Essential Splice Site Mutation detected in F1 DNA During 2016
sa35307 Essential Splice Site Mutation detected in F1 DNA During 2016
sa42045 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa16676
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Nonsense 528 2389 8 36
Genomic Location:
Chromosome 12 (position 29473615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACCACCACCACCTCCACCATCACTATCATTTGGGCAATGGGAGTGTC[C/T]GATCTGACGGGGGACGAGAGGTGGACAATCCTTYGCAGAGTGGCATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Nonsense 623 2389 8 36
Genomic Location:
Chromosome 12 (position 29473901)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGTGCCCTTTGCAGCTCCAGTACATAAGAACTACCCCACTTTACAGT[C/A]ATCTCTGGCCTTAGAGCAGCTCAGACAGAGAATCCTGGATCCTGCTAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Nonsense 976 2389 13 36
Genomic Location:
Chromosome 12 (position 29499267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCCTGTGGCTGCTCTGTACTTCATCGCCCTCATGACCTTTGGGAATTA[T/A]GTCTTGTTTAACCTCTTAGTTGCTATCTTAGTGGAGGGATTCCAAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27964
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Essential Splice Site 1363 2389 20 36
Genomic Location:
Chromosome 12 (position 29543806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCAACTACATATTTACTGCCATCTTTGTGACCGAAATGACAATAAAG[G/T]TAGGTGACGGGTCTCTGTGTGGCATCTACTCTGACAGAGGGTAAACTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35307
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Essential Splice Site 1603 2389 25 36
Genomic Location:
Chromosome 12 (position 29577363)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACGGCGAGAAGCGAAGCGCCAGAAACGACGTGATAAAAAACGAAGGA[G/A]TAAGGAGAAGGAGCTAGCTGGTCGGTAGCCTTTCCACACCTTTCTGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42045
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Essential Splice Site 2049 2389 34 36
Genomic Location:
Chromosome 12 (position 29632337)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCAAACCACAGCACCCACACAACCTCACCTCACCTCGCTCAGACAGG[T/C]GCAGCACCGTATTTTACTTCTACATCTGATTTAACCGTGGTTGTTAATGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link