C3orf63 (2 of 2)

Ensembl ID:
ENSDARG00000089893
Description:
chromosome 3 open reading frame 63 [Source:HGNC Symbol;Acc:30314]
Human Orthologue:
C3orf63
Human Description:
chromosome 3 open reading frame 63 [Source:HGNC Symbol;Acc:30314]
Mouse Orthologue:
D14Abb1e
Mouse Description:
DNA segment, Chr 14, Abbott 1 expressed Gene [Source:MGI Symbol;Acc:MGI:1921694]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37576 Nonsense Mutation detected in F1 DNA During 2016
sa37577 Nonsense Mutation detected in F1 DNA During 2016
sa24227 Nonsense Available for shipment Available now
sa10514 Nonsense Available for shipment Available now
sa43890 Splice Site, Nonsense Mutation detected in F1 DNA During 2016
sa43891 Nonsense Mutation detected in F1 DNA During 2016
sa9869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37576
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 53 1547 3 21
Genomic Location (Zv9):
Chromosome 22 (position 42053548)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39021451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTACGTCAGGGTCGGGTGAAGAGCGTGCACGACTGTATATCCCGATA[T/A]CCAGATAACCGCACGTCCAGAGGGATTGATCCCACACCTAAATTTGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37577
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 82 1547 3 21
Genomic Location (Zv9):
Chromosome 22 (position 42053634)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39021537
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTAAATTTGACAGCCATTTCTCCAAGAGCTCGACTCGCGTGACGTCCT[C/A]ACAGTCACACATGGCTTTTGAGTATACGCAGGTAAAAATAAGCAGACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 949 1547 14 21
Genomic Location (Zv9):
Chromosome 22 (position 42069606)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39037509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGTCAGTGGTAGTTCAGTTGCGGAGACTACGGAAGCTGATGAGGGT[C/T]AAACGTCATGCTCAGCTGTCCCTGCTGAAGACACCTCGGTGGACCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 992 1547 14 21
Genomic Location (Zv9):
Chromosome 22 (position 42069735)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39037638
KASP Assay ID:
2261-7149.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCAGCCTGAGATGATCACTAACCTGGTGGAGATCCTTAAAGGAGTG[C/T]AGAAGAACTCKGTTTACTTCTACATCCATTCCCTGGAGGAGGAGAGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43890
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Splice Site, Nonsense 1109 1547 16 21
Genomic Location (Zv9):
Chromosome 22 (position 42073109)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39041012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTATTGTGTCAGATGAGGATGTCCTGAATCCGTCCGTCATTACAGCA[G/T]GTAACCTGATTATCCAGTCTGGTGTATTACTAAGATCAGGTTTGATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 1283 1547 20 21
Genomic Location (Zv9):
Chromosome 22 (position 42078258)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39046161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACTCCAACCAGGATTCTTCAGATAACACAGTATCTGCCCCCGTATCT[C/T]AGATGACCAGCGCTCTTACAGACCAACAAGCTGACTTCCATCCTTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 1368 1547 20 21
Genomic Location (Zv9):
Chromosome 22 (position 42078515)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39046418
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGACCCTCACCAGAGCTTCCTYGCTCACAGTGCTCTGCCAGATTCCTA[T/A]TGTCTGAGCTCTCCAGAWATCCACAGTCTGCCASAGACGCCAGYCTCGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link