C3orf63 (2 of 2)

Ensembl ID:
ENSDARG00000089893
Description:
chromosome 3 open reading frame 63 [Source:HGNC Symbol;Acc:30314]
Human Orthologue:
C3orf63
Human Description:
chromosome 3 open reading frame 63 [Source:HGNC Symbol;Acc:30314]
Mouse Orthologue:
D14Abb1e
Mouse Description:
DNA segment, Chr 14, Abbott 1 expressed Gene [Source:MGI Symbol;Acc:MGI:1921694]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24227 Nonsense Mutation detected in F1 DNA During 2014
sa10514 Nonsense Available for shipment Available now
sa9869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24227
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 949 1547 14 21
Genomic Location:
Chromosome 22 (position 42069606)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAGGTCAGTGGTAGTTCAGTTGCGGAGACTACGGAAGCTGATGAGGGT[C/T]AAACGTCATGCTCAGCTGTCCCTGCTGAAGACACCTCGGTGGACCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 992 1547 14 21
Genomic Location:
Chromosome 22 (position 42069735)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCTGCAGCCTGAGATGATCACTAACCTGGTGGAGATCCTTAAAGGAGTG[C/T]AGAAGAACTCKGTTTACTTCTACATCCATTCCCTGGAGGAGGAGAGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 1368 1547 20 21
Genomic Location:
Chromosome 22 (position 42078515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGACCCTCACCAGAGCTTCCTYGCTCACAGTGCTCTGCCAGATTCCTA[T/A]TGTCTGAGCTCTCCAGAWATCCACAGTCTGCCASAGACGCCAGYCTCGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/t6ztlnlg