pcdh2ab8

Ensembl ID:
ENSDARG00000089874
ZFIN ID:
ZDB-GENE-041118-7
Description:
protocadherin 2 alpha b 8 [Source:RefSeq peptide;Acc:NP_001009595]
Human Orthologues:
PCDHA1, PCDHA10, PCDHA11, PCDHA12, PCDHA13, PCDHA2, PCDHA3, PCDHA4, PCDHA5, PCDHA6, PCDHA7, PCDHA8, PCDHA9
Human Descriptions:
protocadherin alpha 1 [Source:HGNC Symbol;Acc:8663]
protocadherin alpha 10 [Source:HGNC Symbol;Acc:8664]
protocadherin alpha 11 [Source:HGNC Symbol;Acc:8665]
protocadherin alpha 12 [Source:HGNC Symbol;Acc:8666]
protocadherin alpha 13 [Source:HGNC Symbol;Acc:8667]
protocadherin alpha 2 [Source:HGNC Symbol;Acc:8668]
protocadherin alpha 3 [Source:HGNC Symbol;Acc:8669]
protocadherin alpha 4 [Source:HGNC Symbol;Acc:8670]
protocadherin alpha 5 [Source:HGNC Symbol;Acc:8671]
protocadherin alpha 6 [Source:HGNC Symbol;Acc:8672]
protocadherin alpha 7 [Source:HGNC Symbol;Acc:8673]
protocadherin alpha 8 [Source:HGNC Symbol;Acc:8674]
protocadherin alpha 9 [Source:HGNC Symbol;Acc:8675]
Mouse Orthologue:
AC020968.2
Mouse Description:
protocadherin alpha-3 [Source:RefSeq peptide;Acc:NP_619603]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13592 Nonsense Available for shipment Available now
sa22409 Nonsense Available for shipment Available now
sa22410 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13592
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124485 Nonsense 19 790 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2517414)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2281166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACAAGGATTTAAGTCGTGGATGTATTGTWTCGCAGCGCTYTCCCTTTG[G/A]AATATTACCGATGGGCAGATTGTGTACTCTATATCAGAGGAGGCTGAWCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22409
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124485 Nonsense 74 790 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2517578)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2281002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTTTCAGCTCGTTTCTGGTCCAAATAAGAGGTATTTCGACGTCAATT[T/A]AAAGAGTGGTGTTCTCCTCGTCAAAGAGAGAATAGACAGGGAACTGCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124485 Nonsense 416 790 1 1
Genomic Location (Zv9):
Chromosome 14 (position 2518605)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2279975
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTATCTACTTGTAGATGGTCAGTTAGATCGAGAAACTGCGTCTGAGTA[T/A]AATGTGACAATCAGCGCTGCTGATGAAGGGTCTCCGCCTCTCTCTAGTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link