LOC100001168

Ensembl ID:
ENSDARG00000089871
Human Orthologue:
KIAA1462
Human Description:
KIAA1462 [Source:HGNC Symbol;Acc:29283]
Mouse Orthologue:
9430020K01Rik
Mouse Description:
RIKEN cDNA 9430020K01 gene Gene [Source:MGI Symbol;Acc:MGI:2685174]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42033 Nonsense Mutation detected in F1 DNA During 2016
sa22096 Nonsense Available for shipment Available now
sa11444 Nonsense Available for shipment Available now
sa11840 Nonsense Available for shipment Available now
sa13700 Nonsense Available for shipment Available now
sa38891 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128769 Nonsense 63 1465 1 3
Genomic Location (Zv9):
Chromosome 12 (position 25206902)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23663242
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGTGTGAAATCGCTGAGAAGCGGAAAGGACACAGCGGCGTGAATGGCTA[C/A]GAGGGGGACCATGTTTACAGCGGCGGAGGCATCAGACAAGCTCCTGCCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128769 Nonsense 456 1465 2 3
Genomic Location (Zv9):
Chromosome 12 (position 25209764)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23666104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGCCAGACCATTACAGAGATGGAAGAAGAAGTATGCCCTGCAGGAGA[C/T]AGGCATATCCAGGCTACAGCGAAGAACGGATGGGTAATGTTCAGTACATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11444
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128769 Nonsense 703 1465 2 3
Genomic Location (Zv9):
Chromosome 12 (position 25210507)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23666847
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCACAGATACCAGGTCACTAGAWCCAAGCCAAGACAGTGAAGTTTTTTA[T/A]GCAGGATCCTGGCCTGGAGATCAATACCGAAACCAGGAAACTCAGACAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11840
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128769 Nonsense 808 1465 2 3
Genomic Location (Zv9):
Chromosome 12 (position 25210821)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23667161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCCATCATCCCCAGATCATCAACCTTTGTTGAGAAAGTCTAAACAAT[C/A]ATCAGAAAGTCAAGAGCTTTTTGGACAGTTTTTGCTAAAACCAGTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13700
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128769 Nonsense 808 1465 2 3
Genomic Location (Zv9):
Chromosome 12 (position 25210821)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23667161
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTCCATCATCCCCAGATCATCAACCTTTGTTGAGAAAGTCTAAACAAT[C/A]ATCAGAAAGTCAAGAGCTTTTTGGACAGTTTTTGCTAAAACCAGTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38891
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128769 Nonsense 1200 1465 2 3
Genomic Location (Zv9):
Chromosome 12 (position 25211997)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 23668337
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAACACAGATGCTACAGTTTTGGAAACACAAACCAAAGAGATGAGCT[T/G]AAATGACGAGACACAGAATGTTTGCAGAGAGTTTGAGGAAGTGCCAAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link