CIT

Ensembl ID:
ENSDARG00000089856
Description:
citron (rho-interacting, serine/threonine kinase 21) [Source:HGNC Symbol;Acc:1985]
Human Orthologue:
CIT
Human Description:
citron (rho-interacting, serine/threonine kinase 21) [Source:HGNC Symbol;Acc:1985]
Mouse Orthologue:
Cit
Mouse Description:
citron Gene [Source:MGI Symbol;Acc:MGI:105313]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12291 Nonsense Available for shipment Available now
sa10643 Nonsense Available for shipment Available now
sa12822 Nonsense Available for shipment Available now
sa5276 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122274 Nonsense 423 1989 9 46
Genomic Location:
Chromosome 5 (position 2684944)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCACCCTCGCTCAGGCTTCCACGGCCGAGACCTGCCCTTTGTAGGGYG[G/A]TGCTTCAGTCGGGCCCTCACAGCACTGGCCAAGTCTGAGTGAGTACACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122274 Nonsense 1152 1989 26 46
ENSDART00000122274 Nonsense 1152 1989 26 46
Genomic Location:
Chromosome 5 (position 2577247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTTGAGCTGGCGGTTCGGGAACACAAAGCTGAGATCGTGGCTTTGCAG[C/T]AGGCCCTGAAAGAGCAGAGACTGAAGGCAGAGAGTCTGTCTGACACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122274 Nonsense 1152 1989 26 46
ENSDART00000122274 Nonsense 1152 1989 26 46
Genomic Location:
Chromosome 5 (position 2577247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGTTGAGCTGGCGGTTCGGGAACACAAAGCTGAGATCGTGGCTTTGCAG[C/T]AGGCCCTGAAAGAGCAGAGACTGAAGGCAGAGAGTCTGTCTGACACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122274 Nonsense 1791 1989 41 46
Genomic Location:
Chromosome 5 (position 2533817)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTAATGTGTGTGTGTGTGTGTGTGTGTGTGCAGGAGATCGAGACGTCT[G/T]AACCCTGCAGCTGYATTCACTTCACCGGATACAGTATCATCATCGGCACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hvk0uc49