LOC100331557

Ensembl ID:
ENSDARG00000089850
Human Orthologue:
MYOM2
Human Description:
myomesin (M-protein) 2, 165kDa [Source:HGNC Symbol;Acc:7614]
Mouse Orthologue:
Myom2
Mouse Description:
myomesin 2 Gene [Source:MGI Symbol;Acc:MGI:1328358]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13314 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125593 Nonsense 209 391 4 8
Genomic Location:
Chromosome 13 (position 9571760)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCTCTCTTCTGTATTGTGACGGGGAATCCATGGTGCTCAACTGGAAG[C/T]AGCCCATCCATTCTGGAGGAGCAGAGGTCACCGATTATTACATTGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3m2o2ef9