LOC100331557

Ensembl ID:
ENSDARG00000089850
Human Orthologue:
MYOM2
Human Description:
myomesin (M-protein) 2, 165kDa [Source:HGNC Symbol;Acc:7614]
Mouse Orthologue:
Myom2
Mouse Description:
myomesin 2 Gene [Source:MGI Symbol;Acc:MGI:1328358]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35427 Nonsense Mutation detected in F1 DNA During 2016
sa13314 Nonsense Available for shipment Available now
sa42146 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa35427
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125593 Nonsense 3 391 1 8
Genomic Location (Zv9):
Chromosome 13 (position 9580253)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9691358
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAACACTGGACATGAAAGATAATTTGTAATCTTTCCTTAATGCTCGTG[G/A]TTGCCAAAAGCATGGTCCTCTCAATGCTCAATATTGTGTTTTGCTGGCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13314
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125593 Nonsense 209 391 4 8
Genomic Location (Zv9):
Chromosome 13 (position 9571760)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9699851
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATCTCTCTTCTGTATTGTGACGGGGAATCCATGGTGCTCAACTGGAAG[C/T]AGCCCATCCATTCTGGAGGAGCAGAGGTCACCGATTATTACATTGACAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125593 Nonsense 359 391 7 8
Genomic Location (Zv9):
Chromosome 13 (position 9564705)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 9706906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATATGTTTGAATCTTTTGCAGGTCAAGGGTCTCGAGACAGGCACGTCTTA[T/A]CTGTTTCGCGTGCGGGCAGAGAATGCCAAGGACGTTGGCATGGCTTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link