LOC100147849

Ensembl ID:
ENSDARG00000089847
Human Orthologues:
MUC16, MUC20
Human Descriptions:
mucin 16, cell surface associated [Source:HGNC Symbol;Acc:15582]
mucin 20, cell surface associated [Source:HGNC Symbol;Acc:23282]
Mouse Orthologue:
Muc20
Mouse Description:
mucin 20 Gene [Source:MGI Symbol;Acc:MGI:2385039]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15145 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127798 Nonsense 276 4915 7 55
Genomic Location:
Chromosome 7 (position 74897803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCATCCTTGCCCAGAAACYATGGTGTACAGCCAGTGTGGAAATCCCTG[C/A]ACAGACACCTGTACCARCTCTGAAAGAGGACAAGTGTGTGCGCAGCACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cjf6sw46