LOC100147849

Ensembl ID:
ENSDARG00000089847
Human Orthologues:
MUC16, MUC20
Human Descriptions:
mucin 16, cell surface associated [Source:HGNC Symbol;Acc:15582]
mucin 20, cell surface associated [Source:HGNC Symbol;Acc:23282]
Mouse Orthologue:
Muc20
Mouse Description:
mucin 20 Gene [Source:MGI Symbol;Acc:MGI:2385039]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15145 Nonsense Available for shipment Available now
sa34253 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41088 Nonsense Mutation detected in F1 DNA During 2016
sa34252 Nonsense Mutation detected in F1 DNA During 2016
sa34251 Nonsense Mutation detected in F1 DNA During 2016
sa34250 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41087 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127798 Nonsense 276 4915 7 55
Genomic Location (Zv9):
Chromosome 7 (position 74897803)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72080165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCATCCTTGCCCAGAAACYATGGTGTACAGCCAGTGTGGAAATCCCTG[C/A]ACAGACACCTGTACCARCTCTGAAAGAGGACAAGTGTGTGCGCAGCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127798 Essential Splice Site 496 4915 12 55
Genomic Location (Zv9):
Chromosome 7 (position 74894041)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72076403
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCAGCTTTACATCACAGCCAATTCAGTGTATCAAGGAGAAACATGTGG[T/A]ATTTATCTCTATTCTTTCTTTATTTATTACATGTTTGTTATATTTAACCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41088
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127798 Nonsense 668 4915 16 55
Genomic Location (Zv9):
Chromosome 7 (position 74890117)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72072479
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCAGGCTGACGGTTCCTGCACCCATGATCATGTGCTGGTGGACGGCTG[C/A]GGCTGTGCTGAAGGAAAGTACATGAATGAGAACGGAGACTGTGTTGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34252
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127798 Nonsense 908 4915 22 55
Genomic Location (Zv9):
Chromosome 7 (position 74885223)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72067585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGAGCAATGAGCTGAGACTGACTGATGGATCCTTCCAAGTTGTTCGC[A/T]GAGACGCGGGAGAGGAGATTCCCTACCAGATGCGAACCATGGGGCTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127798 Nonsense 2299 4915 34 55
Genomic Location (Zv9):
Chromosome 7 (position 74876455)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72058817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTACACTTGTGTCCACAACAGTAACTGTTGAATCGTCCACTGAATTT[G/T]AGGTCAGCACCCAGAGTCCATCTTCAACAACAAAACCAATCAAAGCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34250
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127798 Essential Splice Site 4501 4915 45 55
Genomic Location (Zv9):
Chromosome 7 (position 74868375)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72050737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATTGCCCCCATTACAAAAACACTACCATTTTTCACTCTCACCATTCCAG[T/C]GACTACAGACTCCTCTCTTTTCTCAACTACCTCAGAGTTTTGTTGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127798 Nonsense 4673 4915 48 55
Genomic Location (Zv9):
Chromosome 7 (position 74867292)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 72049654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATTCACACTTACCCCAGTCATAACTGCAGATGCCTGCTGTCCAGAGTA[T/A]ACTTGCTGTGAGTATATGATCCACTTATTCTCAGTAAACACTGCAGTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link