si:ch73-77l8.1

Ensembl ID:
ENSDARG00000089833
ZFIN ID:
ZDB-GENE-091118-116
Human Orthologue:
ASB13
Human Description:
ankyrin repeat and SOCS box-containing 13 [Source:HGNC Symbol;Acc:19765]
Mouse Orthologue:
Asb13
Mouse Description:
ankyrin repeat and SOCS box-containing 13 Gene [Source:MGI Symbol;Acc:MGI:2145525]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34319 Nonsense Available for shipment Available now
hu2546 Nonsense Confirmed mutation in F2 line Unknown
sa34320 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126824 Nonsense 66 294 2 6
Genomic Location (Zv9):
Chromosome 8 (position 11562135)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11106989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTCAACATTGTGGCCGTGGACTCCATCACTCCCCTCCATGAGGCCTG[T/A]ATTCAGGGCCATACGCAGTGTGTGAAGCTGCTTCTGGATGCTGGAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2546
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126824 Nonsense 68 294 2 6
Genomic Location (Zv9):
Chromosome 8 (position 11562139)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11106985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACATTGTGGCCGTGGACTCCATCACTCCCCTCCATGAGGCCTGTATT[C/T]AGGGCCATACGCAGTGTGTGAAGCTGCTTCTGGATGCTGGAGCTCATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34320
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126824 Nonsense 276 294 6 6
Genomic Location (Zv9):
Chromosome 8 (position 11569945)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11099179
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCGGGAAAAGAGCGCTGGGGGTTTTCACTCAACTGGGACTCCCAAAC[C/T]GAATCATCTGGTTCCTCTCTTATTTACCGGCTCCTCCTATGGAGCTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link