ENSDARG00000089824

Ensembl ID:
ENSDARG00000089824
Human Orthologue:
PTAFR
Human Description:
platelet-activating factor receptor [Source:HGNC Symbol;Acc:9582]
Mouse Orthologue:
Ptafr
Mouse Description:
platelet-activating factor receptor Gene [Source:MGI Symbol;Acc:MGI:106066]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12936 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12936
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124380 Essential Splice Site 21 110 3 3
Genomic Location:
Chromosome 14 (position 10690613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGGCATTGACGACTCCTTCAAATACAACCTGTATGGTGTTGTGTACA[G/A]TGTTGCATTTGTTCTGGGACTCGCCACAAACTGCGCTTCACTGTTTGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/y015ww0u