LOC100001785

Ensembl ID:
ENSDARG00000089806
Human Orthologues:
CTSL1, CTSL2
Human Descriptions:
cathepsin L1 [Source:HGNC Symbol;Acc:2537]
cathepsin L2 [Source:HGNC Symbol;Acc:2538]
Mouse Orthologues:
4930486L24Rik, BC051665, Cts3, Cts6, Cts7, Cts8, Ctsj, Ctsl, Ctsll3, Ctsm, Ctsq, Ctsr
Mouse Descriptions:
cathepsin 3 Gene [Source:MGI Symbol;Acc:MGI:2151929]
cathepsin 6 Gene [Source:MGI Symbol;Acc:MGI:1889619]
cathepsin 7 Gene [Source:MGI Symbol;Acc:MGI:1860262]
cathepsin 8 Gene [Source:MGI Symbol;Acc:MGI:1860275]
cathepsin J Gene [Source:MGI Symbol;Acc:MGI:1349426]
cathepsin L Gene [Source:MGI Symbol;Acc:MGI:88564]
cathepsin L-like 3 Gene [Source:MGI Symbol;Acc:MGI:1917452]
cathepsin M Gene [Source:MGI Symbol;Acc:MGI:1927229]
cathepsin Q Gene [Source:MGI Symbol;Acc:MGI:2137385]
cathepsin R Gene [Source:MGI Symbol;Acc:MGI:1861723]
cDNA sequence BC051665 Gene [Source:MGI Symbol;Acc:MGI:2682300]
RIKEN cDNA 4930486L24 gene Gene [Source:MGI Symbol;Acc:MGI:1922258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31869 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128811 Essential Splice Site 304 336 7 7
Genomic Location (Zv9):
Chromosome 12 (position 17701619)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16512793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGCTTGATTGCATGTTTTCATATTTTATTATTTCTTTCAACTTTTTTT[A/G]GCTGGTCTGACAAATGGGGTGACAAAGGCTACATCTACATGGCAAAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link